Maintain Proline Level In Chickpea Biology Essay
Abstraction
Pseudomonas aeruginosa strain OSG41, isolated from the heavy metal contaminated H2O irrigated rhizospheric dirt of mustard harvest, tolerated Cr up to the concentration of 1800 µgml-1 and reduced it by 100 % at pH 6-8 after 120 h incubation at 30 to 40 C.
Pseudomonas aeruginosa produced works growth-promoting substances, both in the presence and absence of Cr ; it produced 32 µgml-1 indole acetic acidml-1, in Luria Bertani stock with 100 milligrams tryptophanml-1, solubilized tri-calcium phosphate ( 417µgml-1 ) and secreted 20.8 µgml-1 exopolysachharides ( EPS ) which decreased with increasing concentration of Cr added to growing medium. While look intoing the impact of hexavalent Cr on garbanzo, Cr application to dirty had a phytotoxic consequence. The application of Pseudomonas aeruginosa strain OSG41 even with three times concentration of Cr increased the dry affair accretion, symbiotic properties ( like nodules formation ) , seed output and grain protein of garbanzo compared to non-inoculated workss.
The bio-inoculant decreased the consumption of Cr by 36, 38 and 40 % in roots, shoots and grains, severally. Interestingly, proline accretion decreased significantly by 18.7, 17.8 and 24 % in roots, shoots and seed, of inoculated garbanzo workss, severally. The present determination suggests that the bioinoculant efficaciously reduced the toxicity of hexavalent Cr to chickpea workss and at the same time enhanced the biological and chemical features of garbanzo, when grown in Cr treated dirts. Based on this test, it is suggested that Pseudomonas aeruginosa OSG41could be develop as bioinoculant for heightening the public presentation of garbanzos even in chromium-contaminated dirts which nevertheless, requires farther field proving.
Cardinal words: Chromium, toxicity, garbanzo, Pseudomonas aeruginosa, proline, PGPR
1. Introduction
Chromium is one of the major environmental pollutants which enter the agro-ecosystem from different beginnings like, metal coating, leather tanning, chromate readying, and chilling tower of atomic reactor. Of the assorted signifiers of Cr, hexavalent Cr ( Cr6+ ) is mutagenic and carcinogenic ( Musarrat et al. 2011 ) . After accretion, the elevated concentration of Cr in dirt badly affects the composing and metabolic activities of bugs ( Wani et al. 2007 ; Wani et Al. 2008 ) taking to losingss in dirt birthrate ( Pajuelo et al.
2008 ) . As a consequence of altered dirt birthrate, the deposited Cr in dirt can indirectly ( by cut downing dirt birthrate ) restrict the growing of workss. On the other manus, the consumption and conveyance of Cr to assorted variety meats of workss, may do direct inauspicious impact such as it may ( i ) alter mineral nutrition ( two ) impair photosynthesis and accordingly diminish chlorophyll content ( Wani et al. 2008 ; Wani and Khan 2011a ) ( three ) lessening works growing and seed output ( Wani and Khan 2011b ; Hussain et Al. 2006 ) . These and other associated informations therefore clearly suggests that the toxicity of Cr to variable agro-ecological environments including dirt requires an cheap and effectual scheme to clean up the contaminated sites.
In this context, certain physico-chemical attacks like, electrochemical intervention, ion exchange, precipitation, vaporization, rearward osmosis and deposit have been used for detoxicating Cr polluted environment ( Khan et al. 2009 ; Das and Mathew 2011 ) . However, due to trouble in ( I ) operation at larger graduated table, ( two ) negative impact on the environment and ( three ) prohibitive cost of operation, these physicochemical methods ( Laxman and More 2002 ) have non been widely practiced for Cr remotion. Sing these factors, focal point has been shifted on to happen some cheap option for removing/reducing Cr toxicity from the contaminated parts.
In this respect, the usage of bacterial civilizations particularly the works growing advancing rhizobacteria ( PGPR ) has provided an attractive and low cost option for biological decrease of Cr6+ from contaminated environment ( Congeevaram et al. 2007 ; Wani and Khan 2010 ; Khan et Al. 2012 ) . Mechanistically, PGPR cut down the metal toxicity by different mechanisms such as biosorption, mobilising metals through the elimination of organic acids or bioleaching, immobilisation or bio-mineralization, intracellular accretion, and enzyme-catalyzed transmutation ( Khan et al.
2009 ; Khan et Al. 2012 ) . Apart from metal removal/detoxification, metal-tolerant bugs provide enormously of import foods to workss ( Oves et al. 2010 ) , protect workss from nuisance of phytopathogens by synthesising antimicrobic compounds, cyanogenetic compounds and siderophores and speed up the handiness of plant hormones such as indoleacetic acid ( IAA ) etc. when applied to seed and dirt ( Khan and Zaidi, 2007 ) . As a consequence of these many-sided activities, PGPR heighten the overall growing, and output of workss even when grown in dirts already contaminated with heavy metals or dirts intentionally designed for proving the toxicity of metals or bioremediation potency of bugs.
Compared to the huge and varied built-in functional belongingss of PGPR, there is small information available on the function of metal tolerant PGPR on the growing and development of leguminous plants particularly chickpea when grown deliberately in metal contaminated dirts or in dirts already polluted with heavy metals like Cr. Sing these applied and highly of import agronomic spreads, the present survey was designed to seek for a suited hexavalent Cr cut downing PGPR and to find its proline emphasis cut downing ability and works growth-promoting activity both in the presence and absence of Cr. The growing advancing potencies of the selected metal tolerant bacterial civilization was assessed farther in a pot test experiment utilizing garbanzo ( Cicer arietinum L.
) as a trial harvest.
2. Materials and methods
2. 1 Heavy metal concentration in dirt
The dirt samples for entire heavy metals were collected from the industrial country of Ghaziabad ( S1 ) , Uttar Pradesh, India and conventional ( cultivated ) Fieldss of Faculty of Agricultural Sciences ( S2 ) , Aligarh Muslim University, Aligarh, U.P. , India. There was consistent usage of industrial sewerage H2O, discharged from Hindan River, at site S1.The heavy metals in dirt samples were determined following the method of McGrath and Cunliffe ( 1985 ) utilizing flame atomic soaking up spectrophotometer ( Model GBC 932B Plus atomic soaking up spectrophotometer ) .
All chemicals used for heavy metal analysis were of Analytical class and solutions were prepared in dual distilled H2O.
2. 2 Bacterial strains and rating of metal tolerance
The bacterial strain OSG41 was isolated from the rhizosphere of mustard ( Brassica compestris ) grown at the border of Hindan River near Ghaziabad. The contaminated waste H2O of Hindan River near Ghaziabad was used to water the mustard field as and when required. For reciting bacterial civilizations, King`s B agar medium was used, and the selected civilizations were maintained on this medium until usage. Preliminary trial to place bacterial isolates included settlement morphology, and cultural and biochemical features utilizing standard methods ( Holt et al. 1994 ) . The bacterial strains were tested farther to find resistance/sensitivity against hexavalent Cr ( Cr6+ ) by the Cr amended alimentary agar home base dilution method.
Newly prepared alimentary agar home bases treated individually with increasing concentrations ( 0-2000 µg ml-1 ) of Cr6+ ( used as K2Cr2O7 ) , were spot inoculated with loopful civilization of nightlong adult bacterial civilizations. Home plates were incubated at 28±2 & A ; deg ; C for 48 h. The highest concentration of Cr6+supporting bacterial growing was defined as the maximal tolerance degree ( MTL ) .
2.
3 Strain designation and phyletic tree building
Heavy metal immune bacterium isolate was characterized both biochemically and molecularly ( Table 2 ) . Sequencing of the 16S rDNA of strain OSG41 was done commercially by a DNA sequencing service ( Macrogen, Seoul, South Korea ) utilizing cosmopolitan primers, 518 F ( 5?CCAGCAGCCGCGGTAATACG3? ) and 800R ( 5? TACCAGGGTATCTAATCC3? ) . Nucleotide sequence informations was deposited in the GenBank sequence database. The on-line plan BLAST was used to happen related sequences with known systematic information in the databank at the NCBI web site ( hypertext transfer protocol: //www.ncbi.nlm.
nih.gov/BLAST ) to accurately place strain OSG41. Further, the 16S rDNA cistron sequence of the selected strains was characterized utilizing cosmopolitan primer 518F and 800 R. The sequence ( 1466 bp ) so obtained were analyzed utilizing BLAST ( N ) programme at NCBI waiter ( hypertext transfer protocol: //www.ncbi.
nlm.nih.gov/BLAST ) to place and compare the isolate with the nearest neighbour sequence available in the NCBI database. All the sequence were aligned utilizing Clustal W 1.
6 plan at ( hypertext transfer protocol: // www.ebi.ac.uk/clustalW ) , BLAST alliance tools used bootstrapped neighbour-joining relationship were estimated with MEGA version 4 ( Kumar et al. 2004 ) .
2. 4 Chromium Decrease
The consequence of pH on Cr6+ decrease was assessed utilizing alimentary stock ( NB ) treated with changing concentrations ( 50, 100, 200 and 400 µg ml-1 ) of Cr6+and the autoclaved medium was adjusted to pH 4 to 10 with 1M HCL or 1M NaOH.
A-100 µl of exponentially adult civilization of Pseudomonas aeruginosa OSG41, was inoculated into NB medium incorporating different concentrations, of hexavalent Cr and incubated upto 120 h. For Cr6+ decrease, one milliliter civilization from each flask was centrifuged ( 6000 revolutions per minute ) for 10 min. at 10 ISC, and Cr6+ in the supernatant was determined by the 1,5-diphenyl carbazide method ( APHA, 1995 ; Park et Al. 2000 ) .
2. 5 Bioassay of works growing advancing ( PGP ) activities under Cr emphasis
2.
5. 1 Phosphate solubilization and siderophore production
Assorted PGP activities such as, P-solubilization, indole acetic acid ( IAA ) , siderophores, and H nitrile ( HCN ) of the bacterial strains were assayed both in the presence and absence of the selected Cr salt under in vitro conditions. The phosphate solubilization activity was quantitatively assayed utilizing liquid civilization medium incorporating tri-calcium phosphate ( TCP ) amended with 0, 50, 100, 200 and 400 µg Cr ml-1. The sum of water-soluble P was estimated by a chlorostannous reduced molybdophosphoric acid blue method ( King 1932 ; Jackson 1967 ) . The productions of siderophores by the Pseudomonas aeruginosa OSG41 strain was detected utilizing the Chrome Azurol S ( CAS ) method ( Alexander and Zuberer 1991 ) utilizing the four concentrations ( 50, 100, 200 and 400 µg ml-1 ) of Cr, added to CAS agar home bases. For quantitative appraisal of siderophore, the Pseudomonas aeruginosa OSG41 strain was grown in Modi medium ( K2HPO4 0.05 % ; MgSO4 0.04 % ; NaCl 0.
01 % ; mannitol 1 % ; glutamine 0.1 % ; NH4NO3 0.1 % ) treated with 0, 50, 100, 200 and 400 µgCr ml-1 for 5 yearss and Catechol-type phenolates was measured ( Reeves et al. 1983 ) . For the check, one volume of the Hathway ‘s reagent was added to one volume of sample, and optical density was determined at 560 nanometer for salicylates with Na salicylate as a criterion and at 700 nanometer for dihydroxy phenols with 2,3 DHBA as a criterion.
2.
5. 2 Bioassay of indoleacetic acid and cynogenic compounds
Indole-3-acetic acid synthesized by Pseudomonas aeruginosa OSG41 strain was quantitatively evaluated by the method of Gordon and Weber ( 1951 ) , subsequently modified by Brick et Al. ( 1991 ) . For this activity, the Pseudomonas aeruginosa OSG41 strain was grown in Luria Bertani ( LB ) stock ( gl-1: tryptone 10 ; yeast extract 5 ; NaCl 10 and pH 7.5 ) . A- 100 milliliter of LB holding a fixed concentration ( 100 µg ml-1 ) of tryptophan as a inducer ( Glickmann and Dessaux, 1955 ) and supplemented with 0, 50,100, 200 and 400 µg ml-1 of hexavalent Cr was inoculated with 100 µl civilization ( 108 cells ml-1 ) of P. aeruginosa OSG41 strain and incubated for 7 yearss at 28±2 ISC with agitating at 120 revolutions per minute. After seven yearss, a 5 ml civilization from each intervention was centrifuged ( 8000g ) for 15 min.
and an aliquot of 2 milliliter supernatant was assorted with 100 µl of orthophosphoric acid and 4 milliliter of Salkowsky reagent ( 2 % 0.5 M FeCl3 in 35 % per-chloric acid ) and incubated at 28 ±2 ISC in darkness for 1 h. The optical density of developed tap coloring material was read at 530 nanometer.
The IAA concentration in the supernatant was determined utilizing a standardization curve of pure IAA as a criterion. Hydrogen cyanide production by P. aeruginosa OSG41 strain was detected by the method of Bakker and Schipper ( 1987 ) . For HCN production, P. aeruginosa OSG41 strain was grown on an HCN initiation medium ( g l-1: tryptic soy broth 30 ; glycine 4.4 and agar 15 ) supplemented with 0, 50, 100, 200 and 400 µg ml-1 of hexavalent Cr at 28±2 ISC for 4 yearss.
Further, a loopful civilization of strain OSG41 was placed in the Centre of the Petri home bases, amended with selected concentration of hexavalent Cr. A disc of Whatman filter paper No. 1 dipped in 0.5 % picric acid and 2 % Na2CO3 was placed at the palpebra of the Petri home bases. Home plates were sealed with parafilm. After 4 yearss incubation at 28 ±2 IS C, an orange brown coloring material of the paper bespeaking HCN production was observed.
2. 5.
3 Ammonia and exo-polysaccharide synthesis
For ammonium hydroxide ( NH3 ) sensing, P. aeruginosa OSG41 strain was grown in peptone H2O with 0, 50, 100, 200 and 400 µg ml-1 of hexavalent Cr and incubated at 28±2IS C for 4 yearss. One milliliter of Nessler reagent was added to each tubing and the development of xanthous coloring material bespeaking ammonia production was recorded following the method of Dye ( 1962 ) . The exo-polysaccharide ( EPS ) produced by the Pseudomonas aeruginosa OSG41 was determined as suggested by Mody et Al. ( 1989 ) .
For this, the bacterial strain was grown in 100 milliliter capacity flasks incorporating radical medium supplemented with 5 % saccharose and treated with 0, 50, 100, 200 and 400 of hexavalent Cr. Inoculated flasks were incubated for 5 yearss at 28 ± 2 ISC on a rotary shaker. Culture broth was spun ( 5433 g ) for 30 min. and EPS was extracted by adding three volumes of chilled propanone ( CH3COCH3 ) to one volume of supernatant.
The precipitated EPS was repeatedly washed three times alternately with distilled H2O and propanone, transferred to a filter paper and weighed after nightlong drying at room temperature.
2. 6. 1 Plant growing and metal consumption
Seeds of garbanzo volt-ampere. Avrodhi were surface sterilized with 70 % ethyl alcohol, 3 min. followed by 3 % Na hypochlorite, 3 min.
, rinsed six times with unfertile H2O and shadiness dried. The sterilised seeds were bacterized with P. aeruginosa OSG41, grown in alimentary stock, by dunking the seeds in liquid civilization medium for 2 H utilizing 10 % gum Arabic as adhesive to present about 108 cells seed-1. The non-coated sterilised seeds soaked in unfertile H2O served as control. The non-inoculated and inoculated garbanzo seeds ( 8 seeds per pot ) were sown in clay pots ( 25 centimeter high, 22 centimeter internal diameter ) utilizing 3 Kg unsterilised dirts from agricultural field of Aligarh Muslim University Aligarh ( flaxen clay loam, organic C 0.4 % , Kjeldahl N 0.
75 gkg-1, Olsen P 16 mgkg-1, pH 7.2 and WHC 0.45 mlg-1, Cr 6.5 µgg-1, Cu 18 µgg-1, Ni 14.7 µgg-1, Zn 25 µgg-1, Pb 9.5 µgg-1 and Cd 0.4 µgg-1 ) with control ( without Cr ) and four interventions each with 50, 100, 200, and 400 µgg-1 Cr ( six ) in dirt used in this survey. Six pots used for each intervention were arranged in a complete randomised block design.
Three hebdomads after outgrowth, workss in each pot were thinned to three workss. The pots were watered with tap H2O and were maintained in an unfastened field status. The experiments were conducted for two back-to-back old ages to determine the duplicability of informations.
2. 6. 2 Measurement of biological features, symbiotic efficiency, seed output and metal consumption
All workss in three pots for each intervention were removed at 80 yearss and staying three pots at 130 yearss after seeding ( DAS ) , and was observed for growing and symbiotic properties. Plants uprooted at 80 and 130 DAS were oven-dried at 80 ISC and dry affair was measured. Entire chlorophyll content in fresh leaf of inoculated garbanzo workss grown in Cr stressed and metal free ( control ) dirt was measured at 80 DAS by the method of Arnon ( 1949 ) .
The leghaemoglobin ( Lb ) content in fresh nodules recovered from the root system of garbanzo workss maintained under metal stressed and metal free dirts ( control ) was assessed at 80 DAS ( Sadasivum and Manikam, 1992 ) . Seed output and grain protein was estimated ( Lowery et al. 1951 ) at 130 DAS ( harvest ) . Chromium content in chickpea variety meats ( roots and shoots ) at 80 DAS and roots, shoots and grains at 130 DAS were determined by the method of Ouzounidou et Al. ( 1992 ) .
2. 6. 3 Bioassay of proline
The proline content in roots and shoots of garbanzo workss was determined at 80 DAS while in seed it was assayed at 130 DAS.
A 500 milligram fresh weight of garbanzo works stuffs prepared individually was homogenized with 10 milliliters of 3 % aqueous sulfosalicylic acid. The ensuing homogenate was filtered through Whatman No.2 filter paper. The filtrates were made upto 20 milliliter with 3 % sulfosalicylic acid and used for the appraisal of proline following the method of Bates et Al. ( 1973 ) .
2. 7 Statistical analysis
The experiment was conducted for two back-to-back old ages under the indistinguishable environmental conditions and each intervention was repeated three times. Since the information of the mensural parametric quantities obtained were homogeneous, they were pooled and subjected to analysis of discrepancy. The difference among intervention agencies was compared by high scope statistical sphere ( HSD ) utilizing bipartisan ANOVA at 5 % chance degree.
3. Consequences
3. 1 Entire heavy metal concentration in dirts
Heavy metal in contaminated dirts of Ghaziabad near Hindon River and not polluted dirts of Faculty of Agricultural Sciences, AMU, Aligarh was determined by atomic soaking up spectrophotometer ( Table 1 ) . Heavy metal concentrations in contaminated dirts of Ghaziabad ( S1 ) were ( µgg-1 ) : Cd 16.
4, Cr 108.5, Cu 745, lead 230.5, Nickel 318.5 and Zinc 4580. While Heavy metal concentration in conventional cultivated dirts of Faculty of Agricultural Science ( S2 ) were ( µgg-1 ) : Cd 0.4, Cr 6.5, Cu 18, lead 9.5, nickel 14.
7 and zinc 25.5
3. 2 Word picture and molecular designation of the strain OSG41
The bacterial strain OSG41 recovered from mustard rhizosphere was characterized and identified as Pseudomonas aeruginosa by standard morphological, physiological and biochemical trials. To farther formalize the individuality of the isolate, 16S rDNA sequence analysis of this strain was performed.
The nucleotide sequence of 16S rDNA of OSG41 was found to be about 1466 bp in size. The sequence of the 16S rDNA of this strain was submitted to GenBank ( accession figure HM222648 ) . A similar hunt was performed by utilizing the BLAST plan that indicated that strain OSG41 shared a close relationship with the rDNA sequence of Pseudomonas aeruginosa EU037096.1 ( 16S: 99 % similarity with the mention strain EU037096.
1 ) . Such high similarity values confirmed it as Pseudomonas aeruginosa. A phyletic tree constructed by MEAG 4 package, based on 16S rDNA partial sequence is presented in Fig.
1.
3. 3 Chromium tolerance
In this survey, bacterial strain Pseudomonas aeruginosa OSG41 isolated from the rhizosphere of mustard, grown at the outskirts of Ghaziabad ( 28 & A ; deg ; 40? latitude and 77 & A ; deg ; 25? longitude ) , India was tested against a scope of heavy metals that included Cr+6, Cd2+ , Cu2+ , Ni2+ and Zn2+ in order to set up it as a metal tolerant bacterial strain. Bacterial strain in general showed a variable response to each metal but even the lower concentrations of all tested metals were repressive to all bacterial strains ( informations non shown ) except strain P. aeruginosa OSG41, which tolerated a considerable sum of heavy metals such as Cr+6, Cd2+ , Cu2+ , Ni2+ and Zn2, when grown on alimentary agar home bases amended with the ranked concentrations ( 0-2000 ?g ml?1 ) of each metal. The tolerance degree of P. aeruginosa OSG41 strain against heavy metals ranged above 1200 ( e.
g. , Ni, Cu, Zn ) and 1800 ?g ml?1 ( Cr ) . Among the selected heavy metals, P. aeruginosa OSG41 strain displayed the maximal tolerance against Cr6+ .
The MTL values of the strain OSG41 against each metal were, nevertheless, unusually high ( Table 2 ) .
3. 3.
1 Chromium decrease influenced by environmental variables
3. 3. 1. 1 Consequence of pH on Cr6+ decrease
The consequence of different pH values on P. aeruginosa OSG41 mediated decrease of Cr6+was variable ( Fig. 2 ) . By and large, strain OSG41 was found to significantly cut down Cr at pH scope from 6 to 8 when civilization was grown at 35±2 EsC in the presence of 100 µgCrml-1 added to NB medium. The maximal decrease ( 100 % ) of Cr6+ was nevertheless, observed at pH from 6-8 after 120 h incubation by P.
aeruginosa OSG41, which was followed by pH 5 ( 88 % ) and pH 10 ( 79 % ) . While comparing the consequence of different pH values on Cr decrease by strain OSG41, incubated for variable clip periods, a upper limit of 3.40 times greater decrease was observed at pH 8 comparative to pH 4 after 10 h bacterial growing. Chromium decrease increased significantly with increasing pH and incubation period ; 40 % decrease at pH 6 ( 80ugml-1 ) and 55 % decrease at pH 8 ( 110 ugml-1 ) after 40 H of bacterial growing which increased well by 81 % at pH 6 ( 162 ugml-1 ) and 83 % at pH 8 ( 166 ugml-1 ) after 80 h incubation of P. aeruginosa OSG41 in the presence of 200 µgCrml-1 added to NB medium.
3. 3. 1. 2 Consequence of temperature on Cr6+ decrease.
Temperature is yet another of import factor, which straight affects the growing of bacterial populations and their associated activities including the bio-reduction of hexavalent Cr. By and large, the Cr decrease by the trial bacterial strain increased systematically upto 35 & A ; deg ; C which nevertheless decreased well at 40 & A ; deg ; C. For illustration, P. aeruginosa OSG41 significantly increased the hexavalent Cr decrease by about 20 % at 30 and 35 ( each ) compared to those observed at 25 & A ; deg ; C which nevertheless decreased by about 25 % at 40 & A ; deg ; C relative to those determined at 30 and 35 ( each ) after 120 H at 50 µgCrml-1 ( Fig.
4 ) .
3. 3. 1. 3 Consequence of chromate concentration on Cr6+ decrease
Chromium decrease monitored at different initial concentration runing from 50 to 400 µgml-1 was greatly influenced by P. aeruginosa OSG41 ( Fig.
3 ) . Chromium decrease by the strain P. aeruginosa OSG41 was relatively maximal at lowest concentration of 50 µgml-1 ; complete decrease was observed after 60 h. , at 100 µgCrml-1, complete decrease was achieved after 120h after bacterial growing.
3. 4. 1 Plant growing advancing activities
Hexavalent Cr tolerant bacterial strain OSG41 used in this survey revealed considerable production of PGP substances when grown both with and without hexvalent Cr ( Table 3 ) .
The consequence of four concentrations ( 50, 100, 200 and 400 µgml-1 ) of hexavalent Cr on works growing advancing traits like IAA, P solubilization, exo-polysaccharide ( EPS ) production, siderophores production ( salicylic acid, 2,3-dihydroxybenzoic acid ) , hydrogen nitrile ( HCN ) and ammonia production by P. aeruginosa OSG41 was variable ( Table 4 ) . By and large, the mensural traits of strain OSG41 like, EPS production increased with 100 µgCrml-1 and so decreased with increasing metal concentrations. Likewise, phosphate solubilization, IAA and siderophores activities increasingly decreased with increasing dosage of metal, HCN and ammonia production were nevertheless, non affected by increasing metal concentration. At 400 µgCrml-1 the PGP activities IAA, phosphate solubilising activity, EPS, SA and 2,3-dihydroxybenzoic acid of strain P. aeruginosa OSG41 decreased by 67, 81, 12, 58 and 53 % compared to those observed under metal free medium.
3.
4. 1. 1 Plant growing and symbiotic traits
In this survey, we analyzed the Cr toxicity to chickpea harvest and determined the consequence of bioinoculant on harvest public presentation in metal treated dirt. Chickpea seeds inoculated with works growing advancing rhizobacterium, P. aeruginosa OSG41 grown in flaxen loam dirts amended with different concentration of Cr+6 applied individually, had better growing compared to uninoculated workss ( Table 4 ) . P.
aeruginosa OSG41 strain used as a bioinoculant with 108 µgCrg-1, increased the dry biomass of roots, and shoots, nodule Numberss, nodule biomass and whole works biomass by 68, 52, 27, 23, and 58 % at 80 DAS and 53, 41, 50, 49 and 52 at 130 DAS, severally. Grain outputs recorded for inoculated workss was increased by 40 % , compared to command. While comparing the consequence of bioinoculant ( strain OSG41 ) applied at 216 µgCrg-1 concentrations to those of merely Cr amended dirt, a maximal addition of 63, 67, 50 and 48 % , in root dry mass, shoot dry mass, figure of nodule per works and nodule dry mass at 80 DAS, and root dry mass, shoot dry mass, entire dry mass, nodule mass and nodule figure increased by 71, 60, 62, 36 and 33 % , severally at 130 DAS. The two manner ANOVA revealed that the effects of vaccination and Cr was important ( P?0.05 ) for the mensural parametric quantities. The synergistic consequence of vaccination and Cr was important for all parametric quantity ( Table 4 ) at 80 DAS and 130 DAS.
3.
4. 1. 2 Chlorophyll and leghaemoglobin content
In the absence of bacterial inoculums ( P.aeruginosa OSG41 ) , chlorophyll and leghaemoglobin content of garbanzo workss measured at 80 DAS decreased systematically with increasing concentration of Cr+6 ( Table 5 ) .
Chromium at 216 µgg-1 decreased the entire chlorophyll and legheamoglobin contents by 50 and 33 % severally, comparative to those observed for uninoculated garbanzo workss. In contrast, the bioinoculant increased the chlorophyll content by 30 % and leg-haemoglobin content by 27 % at 108 µgCrg-1 dirt compared to un-inoculate. While comparing the consequence of 216 µgCrg-1 on inoculated and un-inoculated workss, a maximal addition of 32, 38, 35, 15, 31, 35 and 38 % in entire chlorophyll content, leghaemoglobin, N content in roots and shoots, P content in roots and shoots, and seed protein, severally. Two factor ANOVA revealed that the single consequence of vaccination and their interaction ( vaccination – Cr+6 ) were important ( P?0.05 ) for the mensural parametric quantities.
3. 4.
1. 3 Seed output and grain protein
Seed output and grain protein assayed at crop ( 130 DAS ) increasingly decreased with increasing concentration of Cr ( Table 6 ) . Seed output and grain protein of inoculated garbanzos increased by 19 and 21 % , severally, compared to command. In comparing, the Cr cut downing strain P.
aeruginosa OSG41 increased the seed output and grain protein by 39 and 30 % severally, at 108 µg Crg-1 dirt, compared to uninoculated garbanzo workss grown in the dirt treated with similar concentration of Cr. While Cr cut downing P.aeruginosa ( OSG41 ) enhanced the seed output and grain protein by 15 and 9 % severally, at 108 µgg-1 dirt, compared to inoculated but metal free control garbanzo workss. Two manner ANOVA revealed that the single consequence of vaccination and Cr and their interaction ( vaccination – Cr+6 ) were important for the mensural parametric quantities.
3. 5. 1 Chromium consumption
Chromium accretion in roots and shoots of garbanzo workss observed at 80 and 130 DAS, increased with increasing concentration of Cr+6, added to dirty. Maximum chromium consumption like, 46.9 µg Crg-1 and 26.8 µg Crg-1 was determined at 80 DAS in uninoculated workss while 25.5 µgg-1 and 17.
5 µgg-1 in the roots and shoots of inoculated garbanzo workss, severally. Application of bioinoculant ( P. aeruginosa OSG41 ) nevertheless reduced the degree of Cr in roots and shoots by 46.6 % and 35 % severally, measured at 80 DAS ( Fig. 5 ) . At 130 DAS, Cr accumulated in roots and shoots of uninoculated workss were: 72.5 µgg-1 and 33.
6 µgg-1 ( Fig. 6 ) while it was 45 µgg-1 ( roots ) and 20.5 µgg-1 ( shoots ) of P. aeruginosa inoculated chickpea workss. Interestingly, the inoculant bacterial strain ( OSG41 ) decreased the concentration of Cr in roots and shoots by 37 and 63 % , severally at 130 DAS when garbanzo was grown with 216 µgg-1 dirt compared to those observed for uninoculated workss. A maximal lessening in Cr consumption ( 36 % ) was recorded for garbanzo seeds compared to uninoculated garbanzo. While comparing the accretion of Cr in different works variety meats, seeds in general had maximal Cr compared to other tried parts of garbanzo workss.
3.
6. 1 Proline accretion
Proline accretion in the works roots and shoots measured at 80 DAS and grains at 130 DAS increased with increasing concentration of Cr+6, added to dirty. A maximal consumption of 46 and 42 mgg-1 fresh weight was recorded in roots and shoots after 80 DAS when workss were grown without bioinoculant while in the presence of bioinoculant, it was 37.5 and 34.50 mgg-1 fresh weight proline in roots and shoots, severally, at 216 mgkg-1 Cr amended dirt. The application of bioinoculant well declined the proline concentration in roots and shoots of garbanzo workss by 35 % and 18. % severally, after 80 DAS ( Fig.
6 ) Maximum proline ( 63.3 mgg-1 fresh weight ) accretion was recorded in grains collected from uninoculated while it was 48.2 mgg-1 fresh weight in grains of inoculated workss.
4.
Discussion
4. 1 Designation and word picture
The wastewaters discharged from different industries are reported to incorporate variable heavy metals including Cr to an extent of toxicity degree ( Dermou et al. 2005 ) . When used deliberately in agronomic patterns, such wastewaters are known to do displacements in microbic communities taking even to the outgrowth of pollutant ( e.
g. , metal ) opposition among bacterial population ( Stepanauskas et al. 2005 ) . Sing the broad spread resistant/reducing traits among bacteriums, metal cut downing for illustration Cr cut downing works growing advancing rhizobacteria such as Bacillus sp. ( Wani et al. 2007 ; 2011 ; He et al. 2010 ) and Pseudomonas sp. ( Hassan et al.
2008 ; Raja et Al 2006 ) have been isolated and characterized from metal contaminated environment. In this survey we isolated metal tolerant bacterium from dirt having metal incorporating wastewater. Metal tolerant strain ( OSG41 ) was later on identified as Pseudomonas aeroginosa ( Acc no. HM222648 ) utilizing biochemical trials and 16S rDNA sequence word picture and phyletic analysis.
4. 2 Hexavalent Cr decrease
The ability to cut down the toxicity of hexavalent Cr has been found in many bacterial species including PGPR such as Pseudomonas fluorescence ( Bopp et al. 1983 ) , Enterobacter cloacae ( Wang et al. 1989 ) , Bacillus sp. ( Wani et al.
2007 ) and Staphylococcus capitis ( Zahoor and Rehman, 2009 ) . Under both aerophilic and anaerobiotic conditions.The Cr decrease is nevertheless influenced both by changing pH and temperature ( Stewart et al.
2007 ; Van Engelen et Al. 2008 ) . Sing the importance of these environmental variables in Cr decrease, we used a bacterial strain Pseudomonas aeruginosa OSG41 to measure its Cr cut downing ability under altering factors. Interestingly, this strain was able to cut down Cr ( VI ) at broad scope of pH ( 4-10 ) and temperature ( 20-40 IS C ) , as besides reported by others ( Wani et al. 2007 ; Zahoor and Rehman 2009 ) . Furthermore,The growing of Pseudomonas aeruginosa OSG41 and its decrease ability was assessed at varied Cr+6concentration ; the overall rate of Cr+6 decrease decreased with increasing concentration of Cr+6. However, the rate of Cr+6reduction was non inhibited by high degrees of Cr during early stage of decrease procedure.
Similar tendency was observed by Rahman et Al. ( 2007 ) for Pseudomonas sp. C-171 against different concentration of Cr+6. However, among bacteriums, Athrobacter sp.
has been found more efficient Cr cut downing being than Bacillus sp. ( Megharaj et al. 2003 ) while the Arthrobacter oxydans was affected even at a really low ( 35 µgml-1 ) concentration of Cr+6 ( Asatiani et al. 2004 ) .
4. 3 Consequence of Cr tolerant strain ( OSG41 ) on garbanzo grown in Cr treated dirts
Application of bacterial inoculums as biofertilizer has been reported to ensue in better growing and increased output of different harvests ( Zaidi et al. 2003 ; Bushan and Holgiuin, 1997 ; Wani et Al.
2011 ) Sing both the growing advancing efficiency and metal tolerant ability of the Pseudomonas aeruginosa OSG41, we designed an experiment to measure the public presentation of inoculated garbanzo in Cr amended dirts. The consequences are discussed in the undermentioned subdivision.
4. 4 Plant growing and nodulation
By and large, the garbanzo growing expressed both in footings of dry affair and symbiotic properties, was higher for inoculated garbanzo than in uninoculated 1s even when grown in the presence of the changing degree of Cr+6. Like any conventional PGPR, Cr tolerant Pseudomonas aeruginosa OSG41 used as inoculums in this survey caused a significant addition in the overall public presentation of garbanzo likely due to the synthesis of works growing modulating substances ( Wani et al. 2008 ) , reported to advance root growing straight by exciting works cell elongation or cell division ( Minamisawa and Fukai 1999 ) . Furthermore, the HCN, and siderophores bring forthing ability of this discoloration might besides hold enhanced the root growing and consumption of dirt minerals by the host works as besides observed by others ( Zaidi et al. 2006 ; Wani et Al.
2007a ; 2008 ) .Like growing features, the nodules formed on the root system of inoculated garbanzo workss raise in dirt amended with Cr, was significantly higher compared to those observed for uninoculated workss. Besides, the leghaemoglobin content in fresh nodules collected from inoculated garbanzo was greater.
The improved symbiotic relationship measured as nodule Numberss and leghaemoglobin in bacterized leguminous plants host grown in Cr amended dirt is a clear suggestive of the rhizobial constitution and endurance within Cr polluted dirt which despite Cr continued to show its full growing advancing abilities even in the presence of Cr. Similar, addition in the growing of inoculated leguminous plants grown in the presence of metals has been reported by Pajuelo et Al. ( 2008 ) and Wani and Khan ( 2011 ) .
4.
4.1 Chlorophyll, seed output and grain protein
In the absence of bacterial civilization, there was a progressive lessening in the chlorophyll content in fresh leaf measured at 80 DAS and seed output and grain protein after crop. In comparing, Pseudomonas aeruginosa OSG41 increased the measured parametric quantity when garbanzo was grown with different concentration of Cr added deliberately to sandy clay loam dirts. Tripathi et Al. ( 2005 ) has reported a similar addition in the chlorophyll content of greengram [ Vigna radiata ( L ) wilczek ] workss inoculated with siderophore bring forthing and lead and cadmium immune Pseudomonas putida KNP9 under metal stressed status.
Seed output and protein of garbanzo was increased in presence of bioinoculant strain ( Pseudomonas aeroginosa OSG41 ) under influence of Cr in dirt. However, terrible inauspicious effects were recorded when garbanzo was grown with exclusive application of Cr. In a survey similar to the present probe, Chaudhri et Al. ( 2000 ) observed an addition in seed output of pea ( Pisum sativum ) when grown in the presence of bioinoculant under influence of heavy metals for illustration Zn and Cu. While seed protein increased in the presence of bioinoculant ( Klyvera ascorbata SUD165 ) in the presence of heavy metals Zn, Ni and Pb.
4. 5 Chromium accretion
The consumption of Cr in different variety meats such as roots, shoots and grains of garbanzo workss, grown in diversely metal treated dirts increased bit by bit with addition in the concentration of Cr added to dirty.
Interestingly, works growing advancing and Cr cut downing bacterial strain used as a bioinoculant, nevertheless caused a significant diminution lessening in the concentration of Cr in roots, shoots and seed compared to uninoculated harvest. The decrease in Cr concentration in chickpea variety meats therefore exhibited the ability of this strain to protect legume harvest against the repressive consequence of high concentration of hexavalent Cr. Faisal and Husnain ( 2005 ) have besides observed a lesser accretion of Cr in Ochrobacteriam intermedium inoculated Helianthus annus while Wani et Al. ( 2008 ) reported a decreased consumption of Cr by Mesorhizobium inoculated garbanzo workss and concomitantly a important addition in the overall public presentation. In the presence Bacillus sp. inoculated garbanzo when grown in Cr stressed dirts ( Wani and Khan 2011 ) .
4. 6 Proline accretion
Enhanced synthesis of free cellular protein during assorted abiotic emphasiss has been found to supply a multifunctional protective function in most works species ( Hare and Cress 1997 ; Szabados and Savoure, 2010 ) .
For illustration, Schat et Al. ( 1997 ) reported heavy metal-induced accretion of free proline in a metal-tolerant and a nontolerant ecotype of Silene vulgaris. In our survey, we observed a important accretion of proline in garbanzo works variety meats like, roots, shoots and seeds due to high concentration of hexavalent Cr nowadays in dirts and increased with metal concentration proposing that metals likely has inducible consequence on proline synthesis. Proline accretion nevertheless decreased significantly in bacterized workss ( Fig. 4 ) .
6.
Decision
In the present survey, we demonstrate the pytotoxic consequence of hexavalent Cr on the public presentation of garbanzo workss, grown in hexavalent Cr treated flaxen loam dirts. Hexavalent Cr tolerant Pseudomonas aeruginosa OSG41 when used as seed inoculum, nevertheless protected the workss from the toxicity of hexavalent Cr taking thereby to a considerable addition in the dry biomass, alimentary assimilation, seed output and seed protein. The increased growing of garbanzo workss even in the presence of Cr might hold been due to several factors like ( I ) synthesis and release of works growing advancing substances such as phytoharmones, siderophores and EPS by Pseudomonas aeruginosa OSG41 ( two ) Cr cut downing ability of the trial bacterial strain and ( three ) ability of bacterial strain to get the better of the proline accretion in metal stressed environment. Based on these belongingss, the bacterial strain OSG41 of Pseudomonas aeruginosa could be develope as a bioinoculant for its ultimate transportation to legume agriculturists in order to heighten the production of garbanzo in dirt even poisoned with hexavalent Cr.
7. Conflict of involvement
The writers declare that there are no struggles of involvement.
8. Recognition
One of the writers Oves M. is thankful acknowledged to UGC and CSIR New Delhi, India for fiscal aid in signifier of scholarship.
