Cyclodextrin Glucanotransferase Background Information Biology Essay

Cyclodextrin glucanotransferase ( 1,4-?-D-glucan:1, 4-?-glucanotransferase ) or besides known as CGTase is an extracellular enzyme which is a member of ?-amylase household exactly household 13 of glycosyl hydrolases ( Mattson et al. , 1995 ) . This household of enzymes is indispensable enzymes that play critical function in treating amylum. The other name of cyclodextrin glucanotransferase is cyclotransferase gylcotransferase since the CGTase belongs to the enzyme group of Glycosyltransferase Hexosyltransferases ( Gawande and Patkar, 2001 ) .

The construction of CD plays an of import function in its map. The construction of Cadmium can be described as a ring form and the size of the rings differ in types of Cadmium. The ring-shaped of cyclodextrin is formed due to bipolar activity of it where the inside of Cadmiums are hydrophobic and the outside are hydrophilic ( Min, 2006 ) . This makes Cadmium to easy organize inclusion composites with both organic and inorganic molecules ( Min, 2006 ) , where they are capable to include other apolar molecules in instance of geometric compatibility ( Szejtli, 2004 ) . There are three types of Cadmium which are ?-CD, ?-CD and ?-CD with 6, 7 and 8 glucose residues severally. These glucose residues are linked by ?- ( 1-4 ) glycosidic bond. Based on their major production, CGTase can be distinguished as ?-CGTase, ?-CGTase and ?-CGTase ( Li et al. , 2007 ) .

However, the industrial uses of Cadmiums are more efficient with purified signifier of Cadmiums non as combination of ?- , ?- or ?-CD. Therefore, the separation processes which are elaborated and expensive are needed to get the better of this. Restriction like this make the use of Cadmiums at industrial degree are instead limited as the entire remotion of dissolver from the CDs is dearly-won ( Min, 2006 ) .

We Will Write a Custom Essay Specifically
For You For Only $13.90/page!


order now

In order to carry through this, the capableness of CGTase enzymes that able to bring forth increased ratio of merely one peculiar type of Cadmiums is important as it will avoid utilizing expensive and environmental harmful processs affecting organic dissolver. Many researches had been carried out to bring forth fresh CGTase that capable to bring forth specific Cadmiums with high ratio. One of their fresh find was CGTase from Bacillus sp. G1 where it able to bring forth 89 % of ?-CD and can be increase even up to 100 % of ?-CD production through some alteration ( Ho et al. , 2005 ) .

In add-on to this, farther researches had been carried out on Bacillus sp. G1 to increase the industrial value of cyclodextrin. One of the researches was the dual mutant of cyclodextrin at subsite -3 which was done by Goh et Al. ( 2008 ) . This research resulted in production of H43T/Y87F mutation from Bacillus sp. G1 where the ratio of ?-CD and ?-CD had changed from 90:10 to 61:39 ( Goh et al. , 2008 ) . Since ?-CD has high value in at industrial degree due to its high solubility and largest pit, this mutation is used in this research.

The enzyme CGTase is built up by combination of five spheres viz. domain A, sphere B, sphere C, sphere D and domain E. Domain A and B consists of the catalytic residues and signifier substrate binding channel whereas domain C and E act as amylum binding sphere. However, the map of sphere D is still unknown. CGTase are more active at higher temperature as amylum can non be easy hydrolyzed which makes it important to happen out which sphere is critical in thermostability. Certain proves from old surveies and the fact that sphere B contain Ca binding site where the stableness at high temperature can be increased if Ca binds to the site has bring up to this research ( Goh et al. , 2008 )

Therefore, this research will be carried out in order to turn out that sphere B is the sphere that responsible for the thermostability of CGTase. This is because nature has designed sphere B to dwell of Ca adhering site. Attachment of Ca to the site has proven to increase thermostability of CGTase by stabilising the folding or conformation. To turn out this, several molecular methods such as overlapping extension PCR will be used in this survey to replace the sphere B of CGTase belongs to mesophilic Bacillus sp. G1 H43T/Y87F mutation with selected thermophilic bacteriums. This will be done with a subsequent efficient showing and word picture methods to turn out this.

Problem Statement

The proving of sphere B is responsible to the thermostability of CGTase is chiefly done to better the commercial sustainable usage of cyclodextrin. Once the theory had been proved, the pretreatment processs in industrial production of Cadmium can be eliminated.

1.3 Aims

To turn out the thermic stableness of H43T/Y87F CGTase is due to domain B of the enzyme through site-directed mutagenesis method.

To sublimate, express and qualify the mutant enzyme.

Scope of the research

The Scopess of research are as follow:

Planing and synthesising thermophilic sphere B and primers

PCR and overlapping extension PCR

Transformation of the mutant enzyme into E.coli BL21

Positive showing of plasmid and sequencing

Protein look and purification utilizing Ni-NTA affinity chromatography

Protein word picture which includes consequence of pH and temperature to activity and merchandise specifity analysis by HPLC

Chapter 2

LITERATURE REVIEW

2.1 Cyclodextrin

Cyclodextrin ( Cadmium ) or besides known as cyclic dextrin is the byproduct of debasement of saccharides through enzymatic reaction under specific status. This reaction is contact actions by cyclodextrin glucanotransferase. There are three major Cadmiums which are ?-CD, ?-CD and ?-CD with 6, 7 and 8 glucose residues severally ( Li et al. , 2007 ) .

The form of cyclodextrin which is in the signifier of closed ring as shown in Figure 2.1 enables it to organize inclusion composites with assortment of molecules both organic and inorganic which are known as invitee compound ( Volkova et al. , 2000 ) . This increases the capableness of Cadmium to change both chemical and physical belongingss such as solubility and stableness of the encapsulated invitee compounds. This pealing form of CD consists of hydrophobic CH groups on the interior and hydrophilic hydroxyl groups on the outer side of the ring ( Ho et al. , 2005 ) .

Figure 2.1 Structure of ?-CD, ?-CD and ?-CD with their side ironss ( Szejtli, 2004 )

2.1.2 General use of cyclodextrin

Cyclodextrin plays of import function in industries such as decorative, pharmaceutical, agricultural and nutrient industries for a really long clip. Food industries are one of the oldest industries that use Cadmiums. Cadmium is usually used as stabilizers for seasoning agents every bit good as able to cut down unpleasant odors and gustatory sensation ( Loftsson, 2006 ) .

The use of Cadmiums in decorative industry was first brought in by Japan as decorative merchandises are preferred from natural beginning. Therefore, Cadmiums play critical function as stabilizers of chemically labile compound. Other than that, Cadmiums are besides used to obtain drawn-out action and to cut down both unpleasant odor and local annoyance ( Loftsson, 2006 ) .

Apart from that, Cadmiums are besides used widely in pharmaceutical industry starting of 1970s through the production of prostaglandin E2/?-cyclodextrin in Japan. Cadmiums are largely used in this industry as solubilizers, stabilizers and besides to cut down local drug annoyance ( Loftsson, 2006 ) .

Although Cadmiums have a batch of map in pharmaceutical industry, the dose of CD use is instead of import. Since the extra use of CD wile cut down the optimum consequence, hence, Cadmiums are used in really little sum in pharmaceutical industry. This is done taken history of toxicological consideration, production cost and drug bioavailability in CD ( Loftsson, 2006 ) .

Cylodextrin Glucanotransferase ( CGTase )

Cyclodextrin glucanotransferase ( 1,4-?-D-glucan:1, 4-?-glucanotransferase ) or besides known as CGTase is an extracellular enzyme which is a member of ?-amylase household ( Mattson et al. , 1995 ) . CGTase is besides known as cyclodextrin glycosyltransferase, cyclomaltodextrin glucanotransferase and cyclomaltodextrin glycosyltransferase ( Qi and Zimmermann, 2005 ) . CGTase catalyses the cyclization reaction in where amylum are interrupt down into cyclodextrins. This enzyme besides capable to catalyse other reactions such as matching reaction, disproportionation reaction and possesses a hebdomad hydrolyzing activity ( Volkova et al. , 2000 ) . The mechanism of CGTase is shown in Figure 2.2.

Figure 2.2 Reaction mechanism of CGTase which includes disproportionation, hydrolysis and cyclization ( Qi and Zimmermman, 2005 )

Throughout the old ages, CGTase have been identified in many micro-organisms. The first find of it is in Bacillus macerans ( Zimmermann, 20005 ) . Other micro-organisms that capable in bring forthing CGTase are Bacillus firmus, Bacillus circulans, Bacillus autolyticus, Klebsiella pneumonia and Brevibacterium sp. Harmonizing to Zimmermann ( 2005 ) , it had been discovered through genome sequencing that Xanthomonas, Streptococcus and Nostoc strains besides able to bring forth CGTase.

CGTase consists of five intervened spheres viz. domain A, sphere B, sphere C, sphere D and domain E. Domain A shaped as TIM barrel and nowadays in all ?-amylase household members. Domain A and B consists of the catalytic residues and signifier substrate binding channel whereas domain C and E act as amylum binding sphere. However, the map of sphere D is still unknown. Domain C besides contains maltose-binding sites ( MBS ) where this sphere besides involves in stableness of the enzyme. Domain E had been identified to incorporate two maltose-binding sites therefore besides map as a putative raw-starch-binding part ( Shin et al. , 2000 ) .

Figure 2.3 shows the illustration of all the five spheres in CGTase. Domain A is illustrated as A1 and A2 because domain A is a discontinuous sphere where sphere B protrudes out in between sphere A.

Figure 2.3 Conventional representation of the location of each sphere in CGTase

2.3 Thermostability

2.3.1 Thermostability of protein

The thermostability of protein had been long studied by many research workers throughout the old ages. This is important in analyzing the physical and chemical behind protein stableness and folding. Harmonizing to Kumar ( 2000 ) , heat tolenrance enzymes have higher oppositions to proteolysis compared to mesophiles due to their greater rigidness.

Thermostability of proteins have been long discovered in many researches which resulted that thermostability of protein is due to greater hydrophobicity, increased polar surface country, decreased happening of proline residues and addition of salt Bridgess ( Goh et al. , 2008 ) . Proteins at higher temperature besides have higher intrinsic thermic stableness with ability to retain their basic folding characteristic than normal mesophilic proteins ( Seung and Young, 2003 ) .

2.3.2 Thermostability of CGTase

CGTase that is stable and active at high temperature is indispensable in industrial use of Cadmium. This is because due to low optimal temperature of mesophilic CGTase which is merely about 55 & A ; deg ; C, amylum needs an excess intervention before it can be degraded by CGTase. Starch which is stable at high temperature has to be liquefied and solubilize anterior debasement. This procedure will be carried out at temperature every bit high as 110 & A ; deg ; C. Therefore, ?-amylase is added to solubilize amylum ( van der veen et al. , 2000 ) .

However, add-on of ?-amylase green goodss byproduct of maltodextrin. Maltodextrin capable to move as acceptor molecules and competitively inhibits the binding of amylum to CGTase. This in overall reduces the production of CD ( van der veen et al. , 2000 ) .

CGTase which is able to solubilize amylum at high temperature eliminates ?-amylase pre-treatment during the primary liquefaction of amylum or gelatinization. This map of high temperature CGTase shortened the entire clip of cyclodextrin production thereby additions industry value of CD. Besides that, warming and chilling in between bioprocessing stairss can be reduced as good.

There are few thermophiles that are discovered that able to bring forth CGTase where the optimum temperatures of these are higher than the mesophiles. The thermostability of CGTase from mesophilic Bacillus sp. G1 and some of the selected thermophiles is shown in Table 2.1.

Table 2.1 Selected CGTase and their optimal temperature

­­­­­­­­­­_______________________________________________________________________

CGTase Optimum temperature ( & A ; deg ; C ) Mentions

Bacillus sp. G1 60 Goh et Al. ( 2008 )

T. thermosulfurigenes 65 Yamamoto et Al. ( 2000 )

Anaerobranca gottschalkii 65 Goh et Al. ( 2008 )

Chapter 3

MATERIALS AND METHODS

3.1 Man-made cistron stuff

Two man-made thermophilic sphere B will be commercially synthesized in the signifier of recombinant in pUC 57 vector. The two spheres B are from Thermoanaerobacterium thermosulfurigenes and Anaerobranca gottschalkii severally. Both of the Domain B will be substituted into mutant H43T/Y87F to turn out the thermic stableness via overlapping extension PCR.

Figure 3.1 Flow chart of entire research

The sequences of the synthesized sphere B are as follow:

Thermoanaerobacterium thermosulfurigenes

TGGATTTCACGCCAAATCATagcaacccgaacgatgcgggcgaatatggcgcgctgtatgataacggcacctttgtgattgattatccgaccgatgcgaactatgcgaccgtgcatccgattaccaaaagcctgagctatatttataaccataacggcggcattaccaactggaacgatcgctgggaagtgcgctataaaaacctgtttaacctggcggatctgaaccagctgAACACAGTCATGGATCAATA

Anaerobranca gottschalkii

TGGATTTCACGCCAAATCATaccagcccggcggaagtgaacaacccgaactatgcggaagatggcaacctgtataacaacggcgaatttgtggcgagctatagcaacgatctgaacgaaattttttatcattttggcggcaccgattttagcacctatgaagatagcatttatcgcaacctgtttgatctggcgggcctgaacctgaacAACACAGTCATGGATCAATA

In both of the sequences above, the indicated capital missive sequences are from CGTase H43T/Y87F mutation and the staying sequences are from several thermophilic CGTase.

3.2 Glycerol Stock of Desired Bacteria

3.2.1 Preparation of Luria Bertani ( LB ) Media and LB Agar home bases

To fix 500ml of this media, 5.0g of tryptone pulverization, 2.5g of barm infusion and 2.5g of Na chloride will be added into 500ml of distilled H2O and will stir until the pulverization to the full dissolve. The solution will so be autoclaved and kept at 4 & A ; deg ; C.

To fix the agar, 7.5g of agar pulverization will be added into the media and will be dissolved wholly. The media will so be autoclaved and cooled down to pour on Petri dish.

Sterilized Petri dish will be usage to fix the LB Agar home base. In each Petri dish, about 25mL of LB media will be poured. The media will be left to solidify and the coagulated agar home bases will be kept at 4 & A ; deg ; C.

3.3 Transformation of Synthesized Gene into E.coli DH5?

The recombinant plasmid pUC 57 which carry synthesized Domain B is delivered in the signifier of liquid stage. To keep the recombinant and for farther usage, the recombinant will be transformed into the host cell which is E.coli DH5? . Transformation will be done utilizing the TSS method.

3.3.1 Preparation of TSS solution

The TSS solution for bacterial transmutation will be carried out harmonizing to Chung et Al. ( 1989 ) .

To fix 10mL of TSS solution, 8.5mL LB medium will be added to 1mL of PEG, 0.5mL of DMSO and 0.25mL of Mg chloride at pH6.5. The ensuing solution will be stirred until to the full dissolved and autoclaved anterior use. The TSS solution can be kept in 4 & A ; deg ; C as short term storage.

3.3.2 Preparation of TSS bacterial competent cells

An nightlong civilization of E.coli DH5? will be diluted with LB stock at 1:50 dilution factor. The stock will so be incubated in a shaker at room temperature until it reaches the OD reading of 0.25-0.4.

After that, the cell civilization will be kept on ice for 20 proceedingss. The cell civilization will so centrifugate with the velocity of 1500 revolutions per minute for 5 proceedingss at 4 & A ; deg ; C to roll up the pellet. The supernatant will be wholly removed and 1mL of ice-cold TSS solution will be added in each tubing. The cells will be suspended in the solution through soft pipette and the tubings will so be placed in ice for farther usage.

3.3.3 Transformation of TSS-Competent Cells

The ice-cold competent cells in each tubing will be added with 10µL ( 100pg-10ng ) plasmid. The tubing will be gently flicked to blend the competent cells with the plasmid. The tubings will so be incubated in ice for 30 proceedingss with occasional commixture. Immediately after 30 proceedingss, the tubings will be incubated at 42 & A ; deg ; C for 2 proceedingss and followed by incubation in ice for another 2 proceedingss.

The transformed cell will so be added with 0.8mL of LB stock in each tubing. The tubing will be shook for commixture and will be incubated at room temperature in a shaker for about 1 hr.

After an hr of incubation, the transformed cell will be plated on LB agar home bases with ampicilin to test the transformed cells. Approximately 100-200µL of cell civilization will be plated on each home base and left to turn over dark at room temperature.

3.4 Plasmid extraction by the Alkaline Lysis Method

The plasmid will be extracted utilizing Alkaline Lysis method harmonizing to Ausubel ( 1987 ) with alterations.

A individual white settlement will be inoculated into 10mL of unfertile LB/ampicillin stock and adult overnight at room temperature. The following twenty-four hours, 1.5mL of the cells will be transferred into several microcentrifuge tubings and centrifuged for 5 proceedingss at 8000 revolutions per minute to roll up the pellet. The supernatant will be discarded and the tubing will be centrifuged once more to wholly fling any hint of liquid.

The cells in all the tubings will so be transferred into a individual 1.5mL tubing. The combined pellet will be suspended in 100µL GTE solution, vortex briefly for 10 seconds and maintain in ice for 30 proceedingss. This will be followed by add-on of 100 µL of NaOH/SDS solution and the content was inverted several times and placed in ice for 3 proceedingss for the lysis reaction to happen. Following this, 300µL of 5M K ethanoate pH6.0 will be added and the tubing will be inverted few times until a white precipitate formed.

The mixture will be centrifuged at 10 000 revolutions per minute for 5 proceedingss to precipitate the pellet. Approximately 500µL of the supernatant will be transferred into a fresh unfertile 1.5 milliliter tubing. Then, 2 volumes which will be 1000µL of cold absolute ethyl alcohol will be added and the content will be mixed by gently inverting the tubing.

The tubing will be centrifuged at 13 000rpm for 5 proceedingss and supernatant will be discarded. Produced pellet will be suspended in 500µL of 70 % ethyl alcohol and centrifuged at 13 000rpm for 2 proceedingss. The supernatant will be discarded and the plasmid will be air dried for 15 proceedingss.

Finally, the pellet will be dissolved in 50 µL of sterile distilled H2O and stored at -20 & A ; deg ; C for farther usage. Agarose gel cataphoresis will be carried out to find the set and size of the extracted plasmid.

3.5 Polymerase Chain Reaction ( PCR ) Amplification

The elaboration of sphere A1 of CGTase from Bacillus sp. G1 H43T/Y87F mutation, sphere B of CGTase of selected cistrons and domain A2-C-D-E of CGTase from H43T/Y87F mutation will be done individually by adding the undermentioned reagents.

The reagents are 10X buffer, dNTPs, MgCl2, designed cistron specific contrary and forward primers, Template DNA and KOD Polymerase. The reagents will be added together to go 50 µL with the add-on of sterile distilled H2O. The proportion of the reagents will be varied for each elaboration.

PCR is performed utilizing the following protocol where the denaturation, tempering and extension procedure were repeated for 35 rhythms.

Initial denaturation 95 & A ; deg ; C for 2 proceedingss

Denaturation 95 & A ; deg ; C for 20 seconds

Annealing 55 & A ; deg ; C for 20 seconds

Extension 70 & A ; deg ; C for 10 seconds

Final extension 70 & A ; deg ; C for 5 proceedingss

There are three types of primers used in the whole processs. The primers are rearward and forward primers for sphere B, contrary and forward primers for sphere A1 and contrary and forward primers for spheres A2, C, D and E. The forward primers for sphere A1 and contrary primers for spheres A2, C, D and E will so be used as the external primers in overlapping extension PCR. The primers sequences are as follows:

Sphere B frontward primer: 5 ‘ CATGGATTTCACGCCAAATCAT 3 ‘

Sphere B contrary primer: 5 ‘ TAAATATTGATCCATGACTGTGTT 3 ‘

Domain A1 frontward primer ( external frontward primer ) : 5 ‘ CTCGGATCCGGACGTAACAAACAAAGTCAATTACTCA 3 ‘

Domain A1 contrary primer: 5 ‘ ATGATTTGGCGTGAAATCCATG 3 ‘

Domain A2, C, D and E frontward primer: 5 ‘ AACACAGTCATGGATCAATATTTA 3 ‘

Domain A2, C, D and E change by reversal primer ( external contrary primer ) : 5 ‘ GCCAAGCTTCCAATTAATCATAACCGTATCTGTTCCGG 3 ‘

3.6 Overlaping Extension PCR

Overlaping extension PCR will be done with 2 stages. The first stage will be the merger of coveted sphere B with sphere A1 of CGTase mutant H43T/Y87F and the 2nd stage will be the merger of amalgamate sphere A1-B with sphere A2, C, D and E of CGTase H43T/Y87F mutation. The illustration of these two stage processs of the overlapping extension PCR is shown in Figure 3.2.

Separate PCR of all three part

Domain A2, C, D and E of H43T/Y87F CGTase

Domain A1 of H43T/Y87F CGTase

Synthesized sphere B of selected thermophiles

Overlaping -extension PCR between sphere A1 and sphere B

Synthesized sphere B of selected thermophiles

Domain A1 of H43T/Y87F CGTase

Overlaping – extension PCR between sphere A1-B and sphere A2, C, D and E

Domain A2, C, D and E of Bacillus sp. G1 CGTase

Transformation of mutant CGTase into E.coli BL21

Figure 3.2 Conventional diagram of PCR and Overlapping extension PCR

3.7 Transformation of amalgamate CGTase

The process of this transmutation will be similar with the transmutation process at method 3.2 and 3.3.

3.8 Positive showing

3.8.1 Preparation of LB/Ampicilin home bases

In every coagulated LB agar home bases, 100µL of ampicilin ( 100mg/mL ) will be spread and the bed will be left to dry for about 30 proceedingss in laminar flow goon. The home bases are allowed to dry and maintain in 4 & A ; deg ; C for farther usage.

3.8.2 Screening for positive transfomant

This showing will be carried out to place successful transformants. Randomly, a few white settlements will be picked utilizing unfertile toothpicks and will be plated on fresh LB/ampicilin home bases. Plasmid of the selected transformants will be isolated and the size of the recombinant will be identify. Colony PCR attack will be done for choosing plasmid that contains the cistron of involvement.

.

3.9 Sequencing

Positive ringers identified in the earlier measure will be sequenced for verification.

3.10 Protein Expression and Purification

3.10.1 Ni-NTA Affinity Chromatography

Two freshly constructed mutant CGTase with Domain B been substituted will be expressed utilizing pET22/E.coli BL21 system. Post initiation temperature will be lower for case 25 & A ; deg ; C to avoid formation of inclusion organic structure. Cell free supernatant will be batch purification under native status with the usage of tandem 1 mL pre-packed Hi-Trap Ni-NTA Sepharose column ( Amersham Bioscience, GE ) . AKTA Prime will be usage to ease the purification measure. All work will be done at 4 & A ; deg ; C unless specified.

The snap-off terminal of Ni-NTA column mercantile establishment will be removed and distilled H2O will be introduced into the column with the volume of 0.5mL- 1mL perminute. The column will so equilibrated with 7 column volume of adhering buffer which comprise of 20mM of Na phosphate and 5mM of iminazole at pH 7.4. This will be followed by add-on of 20 milliliter of sample into the column.

The elution buffer will so be added with 10 column volume of elution buffer which contain 20mM of Na phosphate, 0.5M of Na chloride and 500mM of iminazole at pH 7.4. The flow rate will be applied at about 1mL/min.

Fraction of samples will be collected utilizing fraction aggregator. Each samples will be assay for protein content and CGTase activity. The fractions with activity will be pooled and dialyzed against 0.1M phosphate buffer at pH 6.0.

3.11 Protein Characterization

Few types of protein word picture checks will be carried out to farther qualify the mutant enzyme. The types of checks that will be carried out include thermostability assay, pH profile and HPLC analysis.

Chapter 4

EXPECTED RESULT

The synthesized thermophilic sphere B is expected to replace the original sphere B in CGTase H43T/Y87F mutation through overlapping extension PCR method. The purified PCR merchandise is expected to clone into E.coli BL21 and plasmid will be extracted to direct for sequencing. The major expected result of this research will be turn outing that sphere B is the sphere that responsible in thermostability of CGTase. In order to turn out this, protein look and word picture will be done.

Mentions

Ausubel, F.M. ( 2000 ) . Current protocol in molecular biological science. John Wiley and

boies, New York, 2:4.6-4.7

Biwer, A. and Heinzle, E. ( 2004 ) . Procedure mold and simulation can steer procedure

development: instance analyze ?-cyclodextrin. Enzyme and Microbial Technology. 34: 642-650.

Chung C.T. , Niemela S.L. and Miller R.H. ( 1988 ) . One-step readying of competent

Escherichia coli: Transformation and storage of bacterial cells in the same solution. Proc. Natl. Acad. Sci. USA. 86: 2172-2175

Gawande, B.N. and Patkar, A.Y. ( 2001 ) . Purification and belongingss of a fresh altogether

amylum degrading- cyclodextrin glucosyltransferase from Klebsiella pneumonia AS-22. J. Enzyme and Microbial Technology. 28: 735-743

Ho, K.S. , Said, M. , Hassan, O. , Kamaruddin, K. , Ismail, A.F. , Rahman, R.A. , N.A.N.

and Illias, R.M. ( 2005 ) . Purification and word picture of cyclodextrin glucanotransferase from alkalophilic Bacillus sp. G1. J. Process Biochemistry. 40 ( 3-4 ) :1101-1111.

Kahar, U.M. ( 2009 ) . Purification and word picture of recombinant cyclodextrin

glucanotransferase ( CGTase ) utilizing chromatography attack. Bachelor of Science with Honours Thesis. Universiti Teknologi Malaysia

Kumar, S. , C.J. Tsai and R Nussinov. ( 2000 ) . Factors heightening protein thermostability.

Protein Eng. Des. and Sel. 18 ( 2 ) :179-191.

Li, Z. , Wang, M. , Wang, F. , Gu, Z. , Du, G. , Wu, J. and Chen, J. ( 2007 ) . ? –

Cyclodextrin: A reappraisal on enzymatic production and applications. Appl. Microbiol. Biotechnol. 77:45-255

Loftsson, T. and Duchene, D. ( 2006 ) . Historical positions: Cyclodextrins and their

pharmaceutical applications. Int. J. of Pharmaceutics. 329:1-11

Mattson, P. , Battchikova, N. , Sippola, K. , and Korpela, T. ( 1995 ) . The function of histidine

residues in the catalytic act of cyclomalodextrin glucanotransferase from Bacillus circulans var. alkalophilus. Biochimca et Biophysica Acta. 1247:97-103

Muniandy, K. ( 2009 ) . Cloning and molecular word picture of Deoxyribonucleic acid fragments

obtained from 5′- RACE of amylum ramifying enzyme from Metroxylon sagu. Bachelor of Science with Honours Thesis. Universiti Malaysia Sarawak, Malaysia.

Ong Rui Min. ( 2005 ) Molecular cloning of cyclodextrin glucanotransferase cistron from

Bacillus sp. G1. Maestro of Science with Honours Thesis. Universiti Teknologi Malaysia

Qi, Q. and Zimmermann, W. ( 2005 ) . Cyclodextrin glucanotransferase: From cistron to

applications. J. Appl. Biotechnol. 66: 475-485.

Seung, P.P. and Young, J.Y. ( 2003 ) . Protein thermostability: Structure- based difference

of residuary belongingss between thermophilic and mesophilic proteins. J. of Mol. Cat. : Enzymatic. 26: 257-264

Shin, H.Y. , Park, T.H. and Lee, Y.H. ( 2000 ) . Site-directed mutagenesis and functional

analysis of Maltose-Binding Site of ?-Cyclodextrin glucanotransferase from

Bacillus firmus volt-ampere. alkalophilus. Biotechnology Letters. 22: 115-121.

Szejtli, J. ( 2004 ) . Past, nowadays and hereafter of cyclodextrin research. J. Pure Appl. Chem.

10: 1825-1845

Volkova, D.A. , Lopatin, S.A. and Varlamov, P.V. ( 2000 ) . One-step affinity purification

of cyclodextrin glucanotransferase from Bacillus sp. 1070. J. Biocatalysis. 33: 67-69

x

Hi!
I'm Ruth!

Would you like to get a custom essay? How about receiving a customized one?

Check it out